Fluidigm Access Array User manual

PN 100-5024 E2
Access Array System for the Ion Torrent
PGM Sequencing System
USER GUIDE
For Use Only with Access Array Reagents

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
2
For technical support visit fluidigm.com/support.
North America [phone] | Toll-free (US/CAN): 866 358 4354 | [email protected]
Latin America [phone] | [email protected]
Europe/Middle East/Africa/Russia [phone] | techsu[email protected]
Japan [phone] | tech[email protected]
China (excluding Hong Kong) [phone] | [e-mail]
All other Asian countries/India/Australia [phone] | [email protected]
For Research Use Only. Not for use in diagnostic procedures.
Information in this publication is subject to change without
notice. It is Fluidigm policy to improve products as new
techniques and components become available. Therefore,
Fluidigm reserves the right to change specifications at any
time. Every effort has been made to avoid errors in the text,
diagrams, illustrations, figures, and screen captures. However,
Fluidigm assumes no responsibility for any errors or omissions.
In no event shall Fluidigm be liable for any damages in
connection with or arising from the use of this publication.
Patent and Limited License Information
Fluidigm products are covered by issued and pending patents
in the United States and other countries. Patent and limited
license information is available at fluidigm.com/legalnotices.
Limited Use License to Perform Preamplification with
Fluidigm IFCs
A license to use Thermo Fisher Scientific's patented
preamplification method workflows involving a Fluidigm
integrated fluidic circuit (IFC) can be obtained (i) with purchase
of a Fluidigm IFC from Fluidigm Corporation or (ii) by a separate
license from Thermo Fisher Scientific. For licensing information,
contact outlice[email protected].
Limited Digital PCR License
A license to use Thermo Fisher Scientific's patented digital PCR
method in all fields other than in the Sequencing Field, the
Mass Spectrometry Field, and the Prenatal Field in workflows
involving a Fluidigm IFC can be obtained (i) with purchase of a
Fluidigm IFC from Fluidigm Corporation or (ii) by a separate
license from Thermo Fisher Scientific. For licensing information,
contact outlice[email protected].
Trademarks
Fluidigm, the Fluidigm logo, Access Array, Advanta, D3, and
FC1 are trademarks or registered trademarks of Fluidigm
Corporation in the United States and/or other countries. All
other trademarks are the sole property of their respective
owners.
For EU's WEEE directive information, go to fluidigm.com/
compliance.
© 2018 Fluidigm Corporation. All rights reserved. 06/2018

Access Array System for the Ion Torrent PGM Sequencing System: User Guide 3
Contents
About This Guide 5
Safety Alert Conventions 5
Safety Data Sheets 6
Chapter 1: Access Array System
Overview 7
Access Array System Components 10
Access Array IFCs 11
Specifications 11
Access Array System Workflow 12
Materials 12
Required Reagents 12
Required Consumables 13
Required Equipment 14
Example Sample and Primer Layout in 96-Well
Plates 14
Before You Begin 15
Chapter 2: Designing Targeted
Sequencing Primers 16
Chapter 3: Target-Specific Primer
Validation for 4-Primer Amplicon
Tagging on the LP 48.48 IFC 17
Reference Documents 17
Materials 17
Required Reagents 17
Prepare Primer Validation Reactions 18
Set Up the PCR Reactions in a 384-Well PCR
Plate 20
Run the PCR Reactions 20
Check PCR Products on the Agilent 2100
Bioanalyzer 21
Chapter 4: Sample Quantitation and
Normalization 22
Reference Documents 22
Materials 22
Required Reagents 22
Required Equipment 22
Sample Quantitation 23
Sample Normalization 23
Chapter 5: Bidirectional Amplicon
Tagging on the LP 48.48 IFC 24
Reference Documents 25
Materials 25
Required Reagents 25
Prime the IFC 26
Prepare the 20X Primer Solutions 28
Prepare Sample Pre-Mix and Samples 29
Prepare the Sample Pre-Mix Solution 29
Prepare the Sample Mix Solutions 29
Load the IFC 30
Thermal-Cycle the IFC 31
Harvest the IFC 31
Attach Sequence Tags and Sample Barcodes 33
Prepare the Sample Pre-Mix Solution 33
Prepare a 100-Fold Dilution of the Harvested PCR
Products 33
Prepare the Sample Mix Solutions 33
Thermal-Cycle the 96-Well PCR Plate 34
Check PCR Products on the Agilent 2100
Bioanalyzer 35
Next Step 35
Chapter 6: Post-PCR Amplicon
Purification and Quantitation 36
Reference Documents 36
Materials 36
Required Equipment 36
Required Reagents 36
Quantitate PCR Products 37
Purify Harvested PCR Products 37
PCR Product Library Quantitation Procedure 38
Agilent 2100 Bioanalyzer Quantification 38
PicoGreen Fluorimetry Quantification 39
Pool the Products from Multiple Access Array
IFCs 39

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Contents
4
Appendix A: Electropherogram Examples 41
Appendix B: Access Array Barcode
Library for the Ion Torrent PGM
Sequencer - 96 43
Appendix C: Related Documents 47
Appendix D: Safety 48
General Safety 48
Instrument Safety 48
Symbols on the Instrument 49
Electrical Safety 50
Chemical Safety 50

Access Array System for the Ion Torrent PGM Sequencing System: User Guide 5
About This Guide
IMPORTANT
•Before using the instrument, read and understand the safety guidelines in this document.
Failure to follow these guidelines may result in undesirable effects, injury to personnel,
and/or damage to the instrument or to property.
•This guide is for preparing sequencing libraries with Access Array™ reagents. To prepare
targeted DNA sequencing libraries with Advanta™ NGS Library Reagent Kits, see the
Advanta NGS Library Preparation with Access Array Protocol (PN 101-7885).
Safety Alert Conventions
Fluidigm documentation uses specific conventions for presenting information that may
require your attention. Refer to the following safety alert conventions.
Safety Alerts for Chemicals
For hazards associated with chemicals, this document follows the United Nations Globally
Harmonized System of Classification and Labelling of Chemicals (GHS) and uses indicators
that include a pictogram and a signal word that indicates the severity level:
Safety Alerts for Instruments
For hazards associated with instruments, this document uses indicators that include a
pictogram and signal words that indicate the severity level:
Indicator Description
Pictogram (see example) consisting of a symbol on a white background within a red
diamond-shaped frame. Refer to the individual safety data sheet (SDS) for the applicable
pictograms and hazards pertaining to the chemicals being used.
DANGER Signal word that indicates more severe hazards.
WARNING Signal word that indicates less severe hazards.
Indicator Description
Pictogram (see example) consisting of a symbol on a white background within a black
triangle-shaped frame. Refer to the instrument user guide for the applicable
pictograms and hazards pertaining to instrument usage.
DANGER Signal word that indicates an imminent hazard that will result in severe injury or death
if not avoided.
WARNING Signal word that indicates a potentially hazardous situation that could result in serious
injury or death if not avoided.
CAUTION Signal word that indicates a potentially hazardous situation that could result in minor
or moderate personal injury if not avoided.
IMPORTANT Signal word that indicates information necessary for proper use of products or
successful outcome of experiments.

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
About This Guide
6
Safety Data Sheets
Read and understand the SDSs before handling chemicals. To obtain SDSs for chemicals
ordered from Fluidigm, either alone or as part of this system, go to fluidigm.com/sds and
search for the SDS using either the product name or the part number.
Some chemicals referred to in this user guide may not have been provided with your system.
Obtain the SDSs for chemicals provided by other manufacturers from those manufacturers.

Access Array System for the Ion Torrent PGM Sequencing System: User Guide 7
Chapter 1: Access Array System Overview
Amplicon tagging on the Access Array™ system significantly reduces the time required for
enrichment of targeted sequences by combining amplicon generation with library
preparation. The Access Array system workflow consists of five major phases: 1) designing
and validating target-specific primers for targeted resequencing, 2) quantifying samples, 3)
running an integrated fluidic circuit (IFC, either the LP 48.48 IFC or the Access Array 48.48
IFC), 4) attaching sequence tags and sample barcodes, and 5) qualifying and quantifying
harvested PCR products for sequencing. The chapters in this user guide detail this workflow
chronologically:
This Access Array target-specific PCR amplification scheme combines 48 target-specific (TS)
forward and reverse primers with 48 samples to generate 2,304 PCR reactions.
Design PCR primers and add tags
Qualify tagged primer sets
Select best tagged primer sets
Quantify samples
Normalize sample concentrations
Load samples and primers on Access Array IFC
PCR amplify for 35 cycles
Recover PCR products from Access Array IFC
Attach sequence tags and sample barcodes
Qualify/quantify PCR products
Select and pool samples
Clean up PCR product pool
Quantify PCR product pool for emulsion PCR

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 1: Access Array System Overview
8
The following image shows a 3 x 3 grid of reaction wells containing the target-specific
primers and samples before reagents are loaded into the LP 48.48 IFC for library preparation
prior to sequencing on the Ion Torrent™ PGM™ Sequencer - 96:
First, TS forward and reverse primers are loaded into each column of the reaction wells on
the LP 48.48 IFC.

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 1: Access Array System Overview
9
Samples are then loaded into each row of reaction wells on the LP 48.48 IFC:
After loading the IFC, each reaction well contains a unique combination of TS primer pairs
and samples:

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 1: Access Array System Overview
Access Array System Components
10
The resulting PCR products of pooled amplicons are as follows:
Access Array System Components
The Access Array system consists of the following components:
•IFCs for Access Array:
•LP 48.48 IFC
•Access Array 48.48 IFC
•IFC Controller AX (2 quantity, for pre-PCR and post-PCR)
•FC1™ cycler
NOTE The stand-alone thermal cycler has been discontinued. It has been replaced by the
FC1 cycler.
IFC Controller AX
Pre-PCR FC1 cycler IFC Controller AX
Post-PCR

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 1: Access Array System Overview
Access Array IFCs
11
Access Array IFCs
Access Array reagents can be run on the:
•LP 48.48 IFC (PN 101-1926)
•Access Array 48.48 IFC (PN AA-M-48.48)
The high-throughput LP 48.48 IFC (or Access Array 48.48 IFC) enables target enrichment of
48 unique samples at the same time.
Specifications
Primer inlets
Sample inlets
Control Line Fluid
H1
H2
H3
H4
well
well
well
well
A1
Interface
accumulator
Containment
accumulator
Description Parameter
Footprint dimensions 128 x 85 x 14 mm
Inlet spacing on input frame 4.5 mm pitch
Primer inlets 48
Sample inlets 48
Reaction chambers 2,304
Reaction volume 35 nL
Instrument compatibility IFC Controller AX, FC1 cycler, and stand-alone thermal cycler

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 1: Access Array System Overview
Access Array System Workflow
12
Access Array System Workflow
The simplicity of running experiments is illustrated in the process below.
The Access Array system workflow consists of five major steps:
Materials
This section describes the materials required to perform an Access Array experiment
including the supported reagents and consumables.
Required Reagents
IMPORTANT
•This guide is for preparing sequencing libraries with Access Array reagents. To prepare
targeted DNA sequencing libraries with Advanta NGS Library Reagent Kits, see the
Advanta NGS Library Preparation with Access Array Protocol (PN 101-7885).
•Store reagents according to manufacturer's storage recommendations as soon as they are
received.
Workflow Step
1Dispense
Transfer samples and primers to the inlets on the LP 48.48 IFC (or Access Array 48.48 IFC)
from a standard 96-well plate, using an 8-channel pipette.
2Load
Reaction mixtures are automatically loaded and assembled on the IFC using the pre-PCR
IFC Controller AX.
3Thermal-cycle
Perform PCR amplification using the FC1 cycler.
4Harvest
PCR products from each sample are automatically pooled and harvested using the
post-PCR IFC Controller AX.
5Recover
Recover the PCR products from each of the 48 sample inlets, using an 8-channel pipette.
Quantify the sequencing library.

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 1: Access Array System Overview
Materials
13
Reagents Supplied by Fluidigm
Reagents from Other Suppliers
Required Consumables
Consumables Supplied by Fluidigm
Product Name Manufacturer Part Number Storage
20X Access Array Loading Reagent Fluidigm 100-0883
–20 °C
1X Access Array Harvest Solution
1X Access Array Harvest Solution is not packaged for
individual sale. It can be purchased in units of 10, under
the name Access Array Harvest Pack, PN 100-3155, or as
a component in the 48.48 Access Array Loading Reagent
Kit, PN 100-1032.
Fluidigm 100-1031
Access Array Hydration Reagent v2
IMPORTANT This reagent is only required when
using the Access Array 48.48 IFC, and it is not for
use with the LP 48.48 IFC.
Fluidigm 100-7966
Access Array Barcode Library for Ion Torrent PGM
Sequencer - 96
Fluidigm 100-4911
Product Name Manufacturer Part Number
FastStart™ High Fidelity PCR System, dNTPack Sigma-Aldrich 04738292001
Agilent® DNA 1000 Kit Agilent 5067-1504
PCR Certified Water Teknova W3330
DNA Suspension Buffer (10 mM TRIS, pH 8.0, 0.1mM EDTA) Teknova T0221
Agencourt®AMPure®XP Reagent Beads Beckman
Coulter
A63880
100% ethanol Major laboratory
supplier (MLS)
—
Product Name Manufacturer Part Number Storage
LP 48.48 IFC or
Access Array 48.48 IFC
NOTE The Access Array 48.48 IFC has
been discontinued. It has been replaced by
the LP 48.48 IFC.
Fluidigm 101-1926
AA-M-48.48
Room temperature
LP Control Line Fluid 48.48 or
Control Line Fluid for 48.48 IFCs
Fluidigm 101-2345
89000020

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 1: Access Array System Overview
Example Sample and Primer Layout in 96-Well Plates
14
Consumables from Other Suppliers
Required Equipment
Equipment Supplied by Fluidigm
Equipment from Other Suppliers
Example Sample and Primer Layout in 96-Well Plates
For ease of pipetting, fill the 96-well plates by columns, not rows.
Product Name Manufacturer Part Number
Microcentrifuge tubes, 1.5 mL MLS —
96- and 384-well PCR plates MLS —
Adhesive seals for PCR plates MLS —
P2-P1000 pipette tips Rainin —
Product Name Manufacturer Part Number
IFC Controller AX (2 quantity, pre-PCR and post-PCR) Fluidigm IFC-AX
FC1 cycler
NOTE The stand-alone thermal cycler has been discontinued. It has
been replaced by the FC1 cycler.
Fluidigm CYC-FC1
Product Name Manufacturer Part Number
DynaMag™-2 Magnet Thermo Fisher
Scientific
123-21D
Agilent 2100 Bioanalyzer® Agilent G2939BA
Microcentrifuge MLS —
Vortex mixer MLS —
Plate centrifuge MLS —
96- and 384-well PCR thermal cycler MLS —
Single-channel P2-P1000 pipettes Rainin —
8-channel P20 pipette Rainin —

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 1: Access Array System Overview
Before You Begin
15
Before You Begin
IMPORTANT Before using the Access Array system, read and understand the detailed
instructions and safety guidelines in Appendix D.
•Use good laboratory practices to minimize contamination of samples:
•Use a new pipette tip for every new sample.
•Whenever possible, separate pre- and post-PCR activities. Dedicate laboratory
materials to designated areas.
•Unless otherwise specified, thaw reagents at room temperature (15–30 °C), and then use
them at room temperature.
•Retrieve only the reagents required from each kit based on the number of IFCs you will
run.
•Only use the reagents provided in the required kit.
•Do not swap reagents between kit lots.
•Mix and centrifuge reagents as directed.
•Avoid creating bubbles when transferring reagents to the IFC.
•This protocols in this document require the use of updated scripts for FC1 (v1.6 or later) and IFC
Controller AX (v2.8 or later) that can be downloaded from fluidigm.com/software.

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
16
Chapter 2: Designing Targeted
Sequencing Primers
You can design your own Access Array target-specific primers using available online tools
(for example, UCSC website at genome.ucsc.edu/cgi-bin/hgGateway, Primer3 website at
bioinfo.ut.ee/primer3/, and in silico PCR at genome.ucsc.edu/cgi-bin/
hgPcr?hgsid=136961442) or by using the D3™ assay design service at Fluidigm.
Our D3™ assay design service provides Access Array target-specific primers for use in
Illumina MiniSeq™, MiSeq™, NextSeq™ and HiSeq® systems and in the Ion Torrent® PGM
system. They are designed to human genomic DNA. Uniplex primers are provided in
nuclease-free water at a final volume of 100 L per well in a single 96-well plate with mixed
forward and reverse primers at a final concentration of 50 M. Multiplex primer sets are
provided in nuclease-free water at a final volume of 100 L per well in six 96-well plates per
set at a final concentration of 60 M.
If you are using primers provided by the D3™ assay design service, refer to the order
informatics packet for primer sequences. If you are designing your own primers, see Access
Array–Generate Tagged Primers Workbook (Fluidigm, PN 100-3873).
This guide is for preparing sequencing libraries with Access Array reagents. To prepare
targeted DNA sequencing libraries with Advanta NGS Library Reagent Kits, see the Advanta
NGS Library Preparation with Access Array Protocol (PN 101-7885).

Access Array System for the Ion Torrent PGM Sequencing System: User Guide 17
Chapter 3: Target-Specific Primer
Validation for 4-Primer Amplicon Tagging
on the LP 48.48 IFC
This chapter describes the validation procedure for the tagged TS primers designed in
Chapter 2.
IMPORTANT Access Array™Barcode 1 primers for the Ion Torrent™ PGM™ Sequencer - 96 must
be ordered prior to primer validation. See Table 1 for oligo sequences and order through an
oligonucleotide vendor.
Reference Documents
Agilent® DNA 1000 Kit Guide
Materials
Required Reagents
IMPORTANT
•This guide is for preparing sequencing libraries with Access Array reagents. To prepare
targeted DNA sequencing libraries with Advanta NGS Library Reagent Kits, see the
Advanta NGS Library Preparation with Access Array Protocol (PN 101-7885).
•Store reagents according to manufacturer's storage recommendations as soon as they are
received.
Reagents Supplied by Fluidigm
Product Name Manufacturer Part Number
20X Access Array Loading Reagent Fluidigm 100-0883
Access Array Barcode 1 primers for Ion Torrent with CS1/CS2 tags Fluidigm —
Target-specific primer pairs tagged with universal tags (CS1 forward tag,
CS2 reverse tag)
50 M CS1–tagged TS forward primer
50 M CS2–tagged TS reverse primer
Fluidigm —

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP 48.48 IFC
Prepare Primer Validation Reactions
18
Reagents from Other Suppliers
Prepare Primer Validation Reactions
The primer validation protocol prepares enough reagents to perform 48 primer validation
reactions.
IMPORTANT It is essential to have Access Array Barcode 1 primers before proceeding with
the primer validation. See Table 1 below for the oligo sequences.
Table 1. Access Array Barcode 1 primers for Ion Torrent
1Prepare the 5X target-specific primer solution for 48 individual primer pairs as shown in
the table below.
Table 2. 5X target-specific primer solution preparation
2Vortex the 5X target-specific primer solution for a minimum of 20 seconds and
centrifuge for 30 seconds.
NOTE The final tagged TS forward and reverse primer concentrations are 250 nM in the
5X primer solution. The final TS forward and reverse primer concentrations in the PCR
reaction are 50 nM.
3Prepare 2 M Access Array Barcode 1 primer solution.
Product Name Manufacturer Part Number
FastStart™ High Fidelity PCR System, dNTPack Sigma-Aldrich 04738292001
Agilent DNA 1000 Kit Agilent 5067-1504
PCR Certified Water Teknova W3330
60 ng/L genomic DNA (optional) Coriell NA17317
Name Sequence (5′-3′)Total Length
A_BC1_CS1 forward primer CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTG
CGTACACTGACGACATGGTTCTACA
62 bp
P1_CS2 reverse primer CCTCTCTATGGGCAGTCGGTGATTACGGTA
GCAGAGACTTGGTCT
45 bp
Component Volume
(μL)
Final
Concentration* (nM)
* The final concentration in this table refers to the amount of each listed component in 5 L of
the final primer solution.
50 M CS1-tagged TS forward primer 1 250
50 M CS2-tagged TS reverse primer 1 250
PCR Certified Water (Teknova) 198
Total 200

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP 48.48 IFC
Prepare Primer Validation Reactions
19
Table 3. The 2 M Access Array Barcode 1 primers for Ion Torrent
4Prepare the primer validation reaction components.
IMPORTANT Warm the 20X Access Array Loading Reagent to room temperature before
use.
Table 4. 4-primer amplicon tagging primer validation reaction preparation
5Vortex the primer validation reaction mix for a minimum of 20 seconds and centrifuge for
30 seconds.
NOTE Table 4 displays the volumes required to prepare 48 reactions with a 25%
overage to evaluate 48 target-specific primer pairs. Scale up appropriately if a higher
number of primer pairs are to be evaluated.
Component Volume
(μL)
Final Concentration
(M)
100 M A_BC1_CS1 forward primer 2.0 2
100 M P1_CS2 reverse primer 2.0 2
PCR Certified Water (Teknova) 96.0
Total 100
Component Volume
(μL)
Volume
for 60 (μL)
Final Concentration*
* The final concentration in this reaction mix table refers to the amount of each listed component in 5 L of the
final reaction mix.
10X FastStart High Fidelity Reaction Buffer
without MgCl2(Roche®)
0.5 30.0 1X
25 mM MgCl2 (Roche) 0.9 54.0 4.5 mM
DMSO (Roche) 0.25 15.0 5%
10 mM PCR Grade Nucleotide Mix (Roche) 0.10 6.0 200 M each
5 U/L FastStart High Fidelity Enzyme Blend
(Roche)
0.05 3.0 0.05 U/L
20X Access Array Loading Reagent
(Fluidigm)
0.25 15.0 1X
2 M Access Array Barcode 1 primers for Ion
Torrent (from step 3)
1.0 60.0 400 nM
60 ng/L genomic DNA
(Coriell)
0.83 49.8 10 ng/L
PCR Certified Water (Teknova) 0.12 7.2
Total 4.0 240.0

Access Array System for the Ion Torrent PGM Sequencing System: User Guide
Chapter 3: Target-Specific Primer Validation for 4-Primer Amplicon Tagging on the LP 48.48 IFC
Set Up the PCR Reactions in a 384-Well PCR Plate
20
Set Up the PCR Reactions in a 384-Well PCR Plate
1Prepare the primer validation PCR reactions:
aAdd 4 L of primer validation reaction mix to each of the 48 wells.
bAdd 1 L of the 5X target-specific primer solution.
The total PCR reaction volume is 5 L.
2Vortex the 384-well PCR reaction plate for a minimum of 20 seconds and centrifuge for
30 seconds.
Run the PCR Reactions
1Load the 384-well plate onto the PCR thermal cycler.
2Run 35 cycles of PCR using the protocol described below:
Table 5. PCR protocol
PCR Stages Cycle
50 ºC 2 min 1
70 ºC 20 min 1
95 ºC 10 min 1
95 ºC 15 sec
60 ºC 30 sec
72 ºC 1 min
10
95 ºC 15 sec
80 ºC 30 sec
60 ºC 30 sec
72 ºC 1 min
2
95 ºC 15 sec
60 ºC 30 sec
72º 1 min 8
95 ºC 15 sec
80 ºC 30 sec
60 ºC 30 sec
72 ºC 1 min
2
95 ºC 15 sec
60 ºC 30 sec
72 ºC 1 min 8
95 ºC 15 sec
80 ºC 30 sec
60 ºC 30 sec
72 ºC 1 min
5